|
 
 |
| ORIGINAL ARTICLE |
|
| Year : 2023 | Volume
: 2
| Issue : 2 | Page : 62-71 |
|
The effects of epigenetic modifiers on the differentiation of human dental pulp stem cells into neural progenitor-like cells
Fakhira Saif Alketbi1, Amir Ali Khan1, Muhammad Tehsil Gul1, Muhammad Nasir Khan Khattak1, Manju Nidagodu Jayakumar2, AR Samsudin3
1 Department of Applied Biology, College of Sciences, University of Sharjah, Sharjah, United Arab Emirates
2 Sharjah Institute of Medical Research (SIMR), University of Sharjah, Sharjah, United Arab Emirates
3 Sharjah Institute of Medical Research (SIMR), University of Sharjah; Department of Oral and Craniofacial Health Sciences, College of Dental Medicine, University of Sharjah, Sharjah, United Arab Emirates
| Date of Submission | 03-Oct-2022 |
| Date of Decision | 21-Jan-2023 |
| Date of Acceptance | 26-Jan-2023 |
| Date of Web Publication | 03-Mar-2023 |
Correspondence Address:
Dr. Amir Ali Khan
Department of Applied Biology, College of Sciences, University of Sharjah, Sharjah 27272
United Arab Emirates
 Source of Support: None, Conflict of Interest: None
DOI: 10.4103/abhs.abhs_53_22
Background: Human dental pulp stem cells (HDPSCs) may be differentiated into neural lineages. The main aim of the study was to assess the DNA demethylation and histone deacetylation inhibition on the differentiation of HDPSCs into neural progenitor-like cells (NPCs).
Methods: HDPSCs were treated with 5-aza2′-deoxycytidine (AZA), DNA methylation inhibitor, and the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) for 3 and 5 days followed by their differentiation into NPCs. The efficiency of the differentiation was evaluated by apoptosis, cellular proliferation, and relative expression of Nestin among the NPCs derived with the different treatments.
Results: Five-day treatment of AZA was crucial for the more efficient demethylation of the HDPSCs. Analysis of the proliferation, apoptosis, and relative expression of the Nestin indicated that the AZA and SAHA neither enhance nor inhibit the differentiation of the HDPSCs into NPCs. Howevere, the expression of Nestin decreased at day 7 in NPCs derived with SAHAH treatment compared with NPCs derived with AZA treatmement. However, there was no difference in Nestin expression in any treatment-derived NPCs compared with control NPCs. All of the NPCs derived from all of the groups were able to differentiate into terminal neurons.
Conclusion: Neither DNA demethylation nor the histone deacetylation has any main effects on proliferation and apoptosis during the differentiation of HDPSCs into NPCs. The only significant effect of the treatments was on the size of the NPCs at day 7; the SAHAH treatment had the smallest NPCs.
Keywords: Differentiation, epigenetic modifiers, human dental pulp stem cells, neural progenitor cells
How to cite this article:
Alketbi FS, Khan AA, Gul MT, Khan Khattak MN, Jayakumar MN, Samsudin A R. The effects of epigenetic modifiers on the differentiation of human dental pulp stem cells into neural progenitor-like cells. Adv Biomed Health Sci 2023;2:62-71 |
How to cite this URL:
Alketbi FS, Khan AA, Gul MT, Khan Khattak MN, Jayakumar MN, Samsudin A R. The effects of epigenetic modifiers on the differentiation of human dental pulp stem cells into neural progenitor-like cells. Adv Biomed Health Sci [serial online] 2023 [cited 2023 Jun 9];2:62-71. Available from: http://www.abhsjournal.net/text.asp?2023/2/2/62/371227 |
| Background | |  |
Neurological disorders represent one of the major threats to human health, as they affect approximately one billion people worldwide [1]. The difficulties to extract neural stem cells from the nervous system make a major challenge to study and treat these neurological disorders [2]. Moreover, the central nervous system is hard to regenerate after an injury or pathological degeneration [3]. In recent years, mesenchymal stem cells (MSCs) have been used widely in regenerative medicine as they have broad differentiation potentials including their differentiation potential of neural lineages [4],[5],[6]. This differentiation potential makes them an attractive source of alternative cells that may be used in neurogenerative disorders instead of neural stem cells.
MSCs are adult stem cells with the potential of multilineages differentiation; these stem cells exist in several tissues in mammalian body such as bone marrow, cord blood, adipose tissue, dermal tissue, various dental tissues, and amnionic tissue [7]. MSCs have been used successfully in preclinical trials on animal models to treat multiple sclerosis, asthma, inflammatory bowel disease, stroke and acute myocardial infarct, and diabetes [8]. These cells have also been used in immune disorder treatment such as graft versus host disease.
Dental pulp stem cells (DPSCs) are MSCs in dental pulp and the represent promising stem cell sources for regenerative medicine because of their ease of extraction and their broader differentiation potential [9]. They retain the broader potential to differentiate into multiple cell lineages including osteoblasts, chondrocyte, adipocytes as well as neuronal cell types [9].
During differentiation, stem cells become specialized and differentiated into other cells by expressing specific group of genes [10]. Cells in the early development are pluripotent [10]. This pluripotency is slowly reduced and lost as the cells differentiate to gain specialized functions to become one of many differentiated cell types. However, by reprogramming differentiated cells to express a certain set of genes, they can be brought back to a more primitive, progenitor or stem cell-like state. The cell's genes expression, epigenetics, shape, size, and energy requirements all change substantially during differentiation [10].
The differentiation of DPSCs into neural lineages may be beneficial in regenerative medicine [11]. To utilize human dental pulp stem cells (HDSCs) into regenerative medicine for neural degenerative disorders, we need to derive effective protocols to enhance the neural differentiation of the HDPSCs. We need to explore epigenetic modulation to enhance this differentiation process.
Human body start with one cell and end up with many different types of cells. During this process, it goes through the various development stages. Epigenetics alterations in the development of embryo such as DNA methylation and demethylation are important during this process [12]. These alterations enable the cell to express the required genes to differentiate into specific cell types [13].
Epigenetics regulate expression of genes without altering the coding sequences. DNA methylation plays a role in gene silencing. During DNA methylation, the addition of methyl group onto the C5 of cytosine in cytosine-guanine island of promoter sequences is done to form 5-methylcytosine (5 mC) [14]. A family of DNA methyltransferases (Dnmts) catalyses DNA methylation by adding methyl group to the cytosine base to form 5 mC [14]. Dnmt3a and Dnmt3b add new methyl group to unmodified DNA and regulate the methylation status in cells (Muhammad et al., 2019) [15]. However, Dnmt1 adds methyl groups based on the methylation pattern on the paternal strand to maintain the DNA methylation. All of the Dnmts are extremely significant for the embryo development. Moreover, Dnmts expression is significantly reduced when the cell reached terminal differentiation [14].
DNA methylation has also a role in genomic imprinting, which leads to the expression of one allele of the two parental alleles. It has also a role in X-inactivation, which insures the expression of one X chromosome in females. Furthermore, it contributes to genomic stability by silencing of retrotransposons [16]. Moreover, DNA methylation is important in silencing transposable and viral elements permanently, which contributes to about 45% of the mammalian genome [14].
DNA demethylation is a process that converts 5 mC back to an unmodified cytosine (C). Many methylated cytosines throughout the genome undergo DNA demethylation. This process occurs in one of two ways and termed as passive or active DNA demethylation. The methylation in the passive demethylation is removed due to the lack of methylation maintenance enzymes after DNA replication. While during the active DNA demethylation ten-eleven translocation enzymes oxides the 5 mC and this initiate the DNA demethylation process [14].
Histone acetylation and deacetylation are another important epigenetic mechanism that has roles in the condensation and decondensation of nucleosome, formation of heterochromatin, and euchromatin [17]. These processes involve acetylation and deacetylation of lysine residues within the N-terminal tail of the nucleosome. It is a reversible process catalyzed by histone acetyltransferase and histone deacetylase (HDAC) [18].
The current study aimed to explore the effects of DNA demethylation and histone deacetylation inhibition on the differentiation of HDPSCs into neural progenitor-like cells (NPCs). The epigenetic modifiers that were used in this study were 5-aza2′-deoxycytidine (AZA), DNA methylation inhibitor, which inhibits the Dnmts (Muhammad et al., 2021) and inhibit the C methylation during the DNA replication. The other modifier used was HDAC inhibitor called suberoylanilide hydroxamic acid (SAHA). This inhibitor inhibits the enzyme which removes the acetyl moity from the histone. Previous studies reported that AZA treatment for 24 h and 3 days. In this study, we have found that 5 days AZA treatment is necessary for the efficient demethylation of the HDPSCs. Once we established the effective demethylation protocol of HDPSCs, we evaluated the effects of DNA demethylation and histone deacetylation inhibition on the neural differentiation of HDPSCs.
| Materials And Methods | | |
The extraction of dental pulp stem cells
Under approved guidelines, normal third molar tooth was collected from the patient at the University of Sharjah hospital. The extracted tooth was washed and kept in phosphate-buffered saline (PBS) (Sigma-Aldrich, USA) solution containing pen/strep (Sigma-Aldrich, USA) on ice, and then washed twice with 70% ethanol and cut slowly to reveal the pulp chamber. After that, pulp tissue was removed and kept in alpha medium containing 20% fatal bovine serum (FBS) and antibiotics on ice. Under sterile conditions, it was washed twice with one ml of wash solution and placed in 100 mm petri dishes with alpha medium containing 20% FBS and antibiotics. Then, with a scalpel bald, the pulp was chopped into small pieces. The pieces were treated 1 ml of 3 mg/ml of collagenase/dispase solution (Roche Diagnostics GmbH, Germany) for 1 h in 37C shaking water bath at 110 rpm. After 30 min, the tube was vortexed and returned to the water bath. After 1-h, cell aggregates were removed by centrifugation. To obtain the single cell suspension, the supernatant was passed through a 70-μM cell strainer (Corning, USA). The cell suspension was centrifuged at 1200 rpm for 5 min and the pellet was resuspended and seeded with complete media of a-MEM (Sigma-Aldrich, USA) supplemented with 20% fetal bovine serum (Sigma-Aldrich, USA), 1% penicillin streptomycin (Sigma-Aldrich, USA and 1% L-Glutamine (Sigma-Aldrich, USA), and at 37C in humidified chamber with 5% CO2. Culture media was changed every 3 days.
Characterization of human dental pulp stem cells
Cells were collected by adding trypsin and incubating for 5 min followed by adding media and centrifugation. Then, supernatant was discarded followed by washing of cells with PBS. Surface markers were stained with fluorescent tagged antibodies against the CD271-PE, CD34-APC, CD106-PE, CD105-APC, CD90-FITC, CD73-FITC, and CD146-PE [19],[20]. The cells were fixed, and the cells were incubated with the antibodies at the dark for 45 min. After that, they were washed with 300 μL PBS twice and resuspended with 300 μL PBS. A FACS-ARIA III machine (BD-Bioscience, Franklin Lakes, NJ, USA) equipped with FACSDiva analytical software was used for the characterization of markers expression. Compensation was done by running either controls as single color or BD CompBeads. The analysis was performed with FlowJo software (BD-Bioscience, Franklin Lakes, NJ, USA).
Cell culture and treatments
HDPSCs were cultured in complete minimal essential media with alpha modifications media containing 10% FBS (Sigma-Aldrich F6178, USA), 1% penicillin streptomycin, and 1% of L-glutamine (Sigma-Aldrich G7513, USA). The cells were kept in a 5% CO2 humidified incubator at 37°C.
When cultured HDPSCs reached 20%–30% confluency, they were serum starved for 24 h to synchronize cell division synchronize cell division and make all of the cells in the G0 phase, then the cells were treated with daily addition of 2 uM of the DNA methylation inhibitor (AZA), 1uM of the HDAC inhibitor (SAHA), combination 2 uM of AZA and 1 uM SAHA, equal volume of Dimethyl sulfoxide (DMSO) as vehicle and PBS as control, for three or five consecutive days in the complete media.
Global DNA methylation assessment
To study the effects of Aza on HDPScs, genomic DNA (gDNA) was extracted using DNA extraction kit (Qiagen, Germany). Global DNA methylation was determined for 100 ng of gDNA using global DNA Methylation Assay Kit (5 mC, ab233486, Abcam). In this assay, DNA bound to strip wells was detected using capture and detection antibodies. After several binding and washing steps DNA methylation was quantified calorimetrically by reading the absorbance at 450 nm in a microplate spectrophotometer.
Differentiation of Human dental pulp stem cells into NPCs
After treating HDPSCs for five consecutive days with the different treatments, they were seeded in nonadhesive 24 well plate with Complete NeuroCult™ Proliferation Medium (50 ml of NeuroCult™ Proliferation Supplement added 450 mL of NeuroCult™ Basal Medium, supplemented with 10ul of both 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml fibroblast growth factor [bFGF]). Cells were differentiated for 7 days, with media change every 2 days. The cells were maintained at 37°C in incubator with 5% CO2 supply. Using image J software, the size and area of the selected NPCs were measured.
Proliferation study
CellTiter 96® AQueous One Solution Cell Proliferation was used to perform proliferation studies (Gatalog # G3580, Promega, USA). Dissociated neutrospheres on the 1st, 3rd and 7th days of differentiation were seeded in 96-wells cell culture plates (1000 cell/well). Absorbance was measured at wavelength 490 nm after incubation of 4 h at 37°C with 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent.
Apoptosis assay
Apoptosis was studied on first, third and 7th days during differentiation using Annexin V-Fluorescein isothiocyanate (FITC) (catalog # BMS500FI-100, Invitrogen, USA). Dissociated neutrospheres derived from HDPSCs treated with PBS, DMSO, AZA, SAHA, AZA and SAHA were incubated with FITC-conjugated Annexin V antibody and propidium iodide for 15 min in the dark. Apoptotic results were obtained by flow cytometry analysis. Compensation was performed by running single color controls.
Terminal differentiation
Dissociated neurospheres from the all treatments were suspended in complete NeuroCult™ differentiation medium (50 ml of NeuroCult™ NS-A Differentiation Supplement added to 450 mL of NeuroCult™ Basal Medium). Then, the dissociated cells were seeded in Poly-D-lysine coated coverslips in 24-well plates with 1 ml of NeuroCult™ differentiation medium. Cells were incubated at 37°C in 5% humidified CO2 incubator for 10 days. Media were changed during the differentiation every 2–3 days.
Immunolabeling to identify terminal differentiated neurons
After 10 days of terminal differentiation, the cells were fixed with 4% paraformaldehyde for 30 min. After that, the cells were washed three times with PBS 3 times for 5 min. To permeabilize cells, 1 ml of 0.3% Triton™ X-100 (in PBS) was added to each well for 5–10 min. Cells were washed 3 times with PBS. The cells were blocked with 10% BSA and primary antibodies, 250 μL of Microtubule-associated protein 2 (MAP2) antibody (primary antibody) diluted in blocking solution, was added to each well. The treated cells were incubated at 37°C for 2 h followed by washing 3 times with PBS. For secondary antibody labelling, 500 μL of diluted (goat anti-mouse immunoglobulin G H and L [FITC]) secondary antibody were added and incubated at 37°C for 30 min. Secondary antibody was washed with PBS 3 times and then distilled water was added. Each immunolabeled coverslip was removed from the 24-well plate and was placed onto the slide in 10 μL mounting media with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA, USA) to view them under confocal microscope.
RNA extraction and quantitative real-time polymerase chain reaction analysis
Using RNeasy Mini Kit (Qiagen, Germany), total RNA was extracted from neurospheres derived in each treatment; then reverse transcription was performed with 500 ng of tRNA using Quantitect Reverse Transcription kit (Qiagen, Germany). Next, cDNA was added to the SYBR green reaction mixture (Quantitect SYBR green Polymerase chain reaction (PCR) kit, 204145, Qiagen, Germany). PCR reaction was performed using Quantstudio3 (Thermofischer) with initial incubation at 95C for 15 min followed by 40 cycles of 95C for 15 s, 60 C for 30 s, and 72 C for 30 s. Target gene expression was corrected with the expression of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The change in gene expression was calculated by ΔΔCT method, using PBS treated group as control. Primers were self-designed, and the sequences of the Primers are listed below.
- GAPDH F: GCTCTCTGCTCCTCCTGTTC
- GAPDH R: CGCCCAATACGACCAAATCC
- Nestin F: GTGGCTCCAAGACTTCCCTC
- Nestin R: GCATCCTGGGCTCTGATCTC.
Statistical analysis
All experimental results were analyzed from the three biological and technical replica. The results were expressed as the means ± standard deviation. Statistical significance was analyzed using the analysis of variance (ANOVA) among the treated groups and post hoc between any two groups with significance at P < 0.05.
| Results | | |
Characterization of human dental pulp stem cells
HDPSCs have fibroblast-like morphology [Figure 1]a. HDPSCs expressed CD105, CD73 and CD 90, and were negative for CD106, CD34, CD271 and CD146 [Figure 1]b. They were also partially positive for the CD106. | Figure 1: Phenotypic analysis of HDPSCs. (a) HDPSCs attached to the surface of the flask exhibiting elongation (arrow), (b) Immunophenotypes of HDPSCs analysed by flow cytometry. HDPSCs: Human Dental pulp stem cells.
Click here to view |
Human dental pulp stem cells growth under the different treatments
HDPSCs were cultured for three or five and were treated consecutive with 2 uM of the DNA methylation inhibitor AZA, 1uM the HDAC inhibitor (SAHA), both AZA and SAHA, equal amount of DMSO and PBS. Confluences of the cells under the different treatments at days two were similar to each other (about 30% confluency), whereas at day 5 the confluences of cells treated with DMSO and PBS were higher than the cells treated with AZA, SAHA, AZA and SAHA treatments [Figure 2]. The final confluency was different for the different treatment indicating effects of the treatments on proliferation [Figure 2]. | Figure 2: HDPSCs at day 2 and 5 showing confluences in different treatments. (a) AZA, (b) SAHA, (c) AZA + SAHA, (d) DMSO, (e) PBS. Confluences of the cells under the different treatments at days two were similar to each other (about 30% confluent), whereas at day 5 the confluences of cells treated with DMSO and PBS were higher than the cells treated with AZA, SAHA, AZA and SAHA combination. HDPSCs: Human Dental pulp stem cells. AZA: Aza2′-deoxycytidine, SAHA: Suberoylanilide hydroxamic acid, PBS: Phosphate-buffered saline, PBS: Phosphate-buffered saline, DMSO: Dimethyl sulfoxide.
Click here to view |
Global DNA methylation level
With the treatment of AZA for 5 days reduced more the level of methylation of DNA compared to 3 days treatment. Cells treated with AZA for 3 days had almost the same level of DNA methylation of DMSO and PBS. DMSO and PBS have almost the same level of methylated DNA in both treatments.
Formation and proliferation of NPCs
[Figure 3]a, [Figure 3]b, [Figure 3]c, [Figure 3]d, [Figure 3]e shows the NPCs generation were formed from HDPSCs after the different treatments. The NPCs were formed in all conditions though at day 7 their sizes vraied among the different treatment groups. There was significant variation in the sizes of the NPCs at day 7 [Figure 3]f. The SAHAH derived NPCs have lowest area at day 7. | Figure 3: NPCs at days 1, 3 and 7 derived under different treatments (a) AZA, (b) SAHA, (c) AZA + SAHA, (d) DMSO, (e) PBS, (f) The sizes of the NPCs at day 7. The ANOVA and post hoc analysis indicates that there is significant variation in NPCs size at the day 7. SAHAH derived NPCs have the smallest NPCs; b, c, e and d shows significant variation with AZA, SHAH, AZA and SAH combination and DMSO respectively. AZA: Aza2′-deoxycytidine, SAHA: Suberoylanilide hydroxamic acid, PBS: Phosphate buffered saline, DMSO: Dimethyl sulfoxide.
Click here to view |
To asess the effects of the different treatments on the proliferation during the differentiation of NPCs, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were performed at day 1, 3 and 7; there was no significant difference among NPCs proliferation derived with different treated groups [Figure 4]. This suggests that the treatments do not affect the proliferation of the NPCs during early neurogenesis of the HDPSCs. The size and the area of selected NPCs were also measured. On day 7, we found overall significant difference (P < 0.05) among the groups. Using Tukey HSD post hoc test, we found that treatment with AZA + SAHA significantly (P < 0.05) increased the size of NPCs compared to AZA and SAHA alone and also to the vehicle (DMSO) treated group. SAHA-derived NPCs were smallest of all.
The same way, AZA + SAHA, though didn't achieve significant difference with PBS treated control and SAHA alone, however, showed increasing trends. It indicates, that at day 7, although AZA and SAHA alone didn't show any significant effect, however, combination of the two drugs increased the size of the differentiated neurons.
Apoptotic analysis of NPCs at days 1, 3 and 7.
To elucidate the effects of different treatments on the survival and apoptosis of NPCs during the differentiation, the apoptosis was studied in the NPCs derived from all treatments at day 1, 3, and 7 using Annexin V kit. The results showed that there is no significant difference in apoptosis of NPCs derived with the treatment groups [Figure 5].
Quantitative real-time polymerase chain reaction
Total RNAs were cextracted from NPCs derived with the treatments, and real time PCR was performed on nestin gene. Experssion counts were normalized by amplifying the cDNA of the same sample using primers against the housekeeping gene, GADPH. The realtive expression of nestin did not vary significantly among the treated groups, except for SAHA treated group at day 7 [Figure 6], which shows significant douwnregulation of nestin (P < 0.05) compared with AZA. Howevere, there was no significant varition in the expression of the nestin in any group compared with control. | Figure 6: Quantitative real-time polymerase chain reaction analysis. Expression plots of Nestin gene in each treatment group. RT-PCR: Real-time polymerase chain reaction.
Click here to view |
Terminal differentiation of NPCs into neurons
To show the potential of NPCs to differentiate into terminal neurones, the NPCs derived from the all treatment groups were seeded onto Poly-D-lysine coated glass coverslips with complete NeuroCult™ differentiation media (NeuroCult™ Basal Medium supplemented with of NeuroCult™ NS-A Differentiation supplement). NPCs from the different treatments were able to differentiate into neurons on day 9 [Figure 7]. Cells were able to attach and start to change the morphology on day 5. Moreover, differentiated cells from the different groups expressed the mature neuronal protein MAP2 validating the terminal differentiation of NPCs into neurons [Figure 8]. | Figure 7: Terminal differentiation of NPCs at days 2,5,7 and 9. (a) AZA, (b) SAHA, (c) AZA + SAHA, (d) DMSO, (e) PBS. PBS Phosphate-buffered saline. AZA: Aza2′-deoxycytidine, SAHA: Suberoylanilide hydroxamic acid, PBS: Phosphate buffered saline, DMSO: Dimethyl sulfoxide.
Click here to view |
 | Figure 8: Immunolabeling of terminally differentiated Cells. NPCs from different treatments were differentiated using complete NeuroCult™ differentiation medium and were stained with MAP2 neural marker, (a) AZA, (b) SAHA, (c) AZA + SAHA, (d) DMSO, (e) PBS. SAHA: Suberoylanilide hydroxamic acid, PBS: Phosphate-buffered saline. AZA: Aza2′-deoxycytidine, DMSO: Dimethyl sulfoxide.
Click here to view |
| Discussion | | |
The differentiation of HDPSCs into neural lineage has great therapeutic potential to treat neurodegenerative disorders. HDPSCs represent the easy viable source for neural differentiation [9]. They possess the ability to differentiate into multiple cell lineages including neuronal cell lineages [20],[21]. Király et al., 2009[22] were the first to differentiate HDPSCs into functional neuronal cells.
The functions and identities of cells are determined by epigenetic factors, as these factors influence the transcriptome of cells [23]. In mammals, DNA methylation of cytosine is a crucial epigenetic factor, and the process can control up to 50% of genes expression [24]. DNA methylation and histone deacetylation are the two main epigenetic processes that regulate genes expression [25]. The DNA demethylation can change the lineage of a particular somatic cells to a new somatic cell [26].
Dedifferentiation is a process by which differentiated cells lose their specialization to return to an earlies cell state. In current study, we evaluated the effects of the DNA demethylation and inhibition of Histone deacetylation during the differentiation of HDPSCs into NPCs. Prior to differentiation, HDPSCs were treated with the epigenetic modifiers AZA, SAHA and combination of AZA and SAHA for 3 or 5 days. The 5-day treatment of AZA was more effective than 3 days treatment of the HDPSCs. Other study has treated HDPSCs with 1 μmol/L AZA for 24 h before differentiation, and they found that AZA significantly inhibits the proliferation and enhances the differentiation of odontogenic differentiation of HDPSCs [27].
Previous studies reported that treatment of MSCs with basic bFGF and EGF in suspension differentiate MSCs into neural progenitor-like cells (NPCs) [28],[29]. In current study, we also used these factors to differentiate HDPSCs into neural progenitor-like cells (NPCs). During the differentiation, neurospheres was formed from HDPSCs in all treatment. All groups had almost the same neurospheres size at day 3 [Figure 4], however the neurosphere sizes increased every day. At day 7, the sizes of neurospheres derived with the combination of AZA and SAHA, DMSO and PBS had bigger sizes than the other treatments– AZA and SAHA. The size of the NPCs derived with SAHAH at day 7 were the smallest of the NPCs derived with all other treatments. However, the enlargement in the sizes did not have any effects on the proliferation and apoptosis. Furthermore, NPCs derived with SAHA and combination of AZA and SAHA had blurry neurospheres borders at day 3 and 7, whereas AZA treated cells showed clearer neurospheres borders [Figure 3]. Cells treated with PBS and DMSO had noticeably clear neurospheres borders [Figure 3]. The neurospheres area analysis suggest that SAHA treatment might have some effect on the cells. SAHAH derived NPCs at day 7 were shortest of all while the AZA and SAHAH combination had the largest NPCs [Figure 3]f. However, these effects were not translated in the in the cellular proliferation, apoptosis and Nestin expression at day 1 and day 3. The expression of Nestin varied at day 7 but the variation was only significant between AZA and SAHA treated samples.
The proliferation and apoptotosis of NPCs were studied at day 1, 3 and 7 during the differentiation; the results showed that there is no significant variation in the proliferation and apoptosis among NPCs derived from all the treated groups [Figure 4] and [Figure 5]. In recent study, it was demonstrated that the differentiation of human adult-derived stem cells, including HDPSCs, towards a neural lineage occurs through a dedifferentiation step followed by differentiation to neural phenotypes [30]. However, our results indicate that demethylation by AZA and the histone deacetylation inhibition by SAHA might not have any effect on the dedifferentiation the HDPSCs. The enhanced NPCs formation should exhibit higher proliferation, low rate of apoptosis, and higher Nestin expression [5]. Therefore, we hypothesized that the treatment of AZA and SAHA prior to the differentiation would affect the differentiation of HDPSCs toward NPCs.
The enhanced differentiation of HDPSCs into neural lineages will target patients with neurodegenerative diseases and spinal cord injuries. Currently, these disorders have poor prognosis as the endogenous neural stem cells in the nervous system cannot be extracted nor can they be activated to treat these disorders. Hence, these disorders are difficult to teat with the endogenous neural stem cells.
Other sources of the stem cells with neural differentiation capability such as HDPSCs needs to be applied for tried for their therapeutic effects.
| Conclusion | | |
Our results indicate that the epigenetics modifiers such as SAHAH and AZA do not have any main effects on the differentiation of HDPSCs into NPCs. However, there were differences in the sizes of the NPCs derived with different treatment. There are different theories of the neural differentiation of MSCs. One model suggests the MSCs differentiation into neural lineages are due to the dedifferentiation of the MSCs (HDPSCs) cells and then their subsequent differentiation into neural lineage in the differentiation media [30]. Another model suggests that a subpopulation of MSCs that originated from neural crest cells differentiate into neural lineage [31]. Further study such as transcriptomics and proteomics analysis needs to be carried out to unravel the molecular process that govern this differentiation. The enhanced differentiation of the DPSCs into neural lineage will lead to the successful treatment of the neural degenerative disorders and spinal cord injury.
Study limitations
NPCs were anlyzed only for the proliferation, apoptosis, and expression of Nestin. The differentaited neurons were only tested with the expression of MAP2 marker. Patch clamp study of the differentaited neurons could not be craried out.
Acknowledgments
[Figure 9] was created using the biorender website (www.biorender.com).
Authors' contributions
FSA and AAK conceived the research concepts; FSA and AAK designed the study; FSA and MTG conducted the experiments; FSA, AAK, MTG, MNKK, MNJ and ARS analysed the data; FSA, AAK, MTG, MNKK, MNJ and ARS validated the results, and the analysis; FSA and AAK prepared the manuscript; FSA, AAK, MTG, MNKK, MNJ and ARS edited and reviewed the manuscript. All of the authors approved the final draft. All authors are responsible for the contents and integrity of this manuscript.
Ethical statement
Ethical approval for this study was granted by the ethical committee at University of Sharjah with approval number: REC-20–01-28–02. All the procedures followed were accordance to ethical standard.
Financial support and sponsorship
This study was funded by Sandooq Al Watan Fellowship Project Grant with grant number: 0046, by College of Graduate Studies at University of Sharjah, UAE, for thesis support for master study and by the targeted grant for the research at the university of Sharjah:1802145073.
Conflict of interests
A.R. Samsudin is an editorial member of the Advances in Biomedical and Health Sciences Journal. No conflict of interests declared.
| References | | |
| 1. | Madanagopal TT, Franco-Obregón A, Rosa V. Comparative study of xeno-free induction protocols for neural differentiation of human dental pulp stem cells in vitro. Arch Oral Biol 2020;109:104572.  |
| 2. | Urraca N, Memon R, El-Iyachi I, Goorha S, Valdez C, Tran QT, et al. Characterization of neurons from immortalized dental pulp stem cells for the study of neurogenetic disorders. Stem Cell Res 2015;15:722-30. |
| 3. | Borkowska P, Fila-Danilow A, Paul-Samojedny M, Kowalczyk M, Hart J, Ryszawy J, et al. Differentiation of adult rat mesenchymal stem cells to GABAergic, dopaminergic and cholinergic neurons. Pharmacol Rep 2015;67:179-86. |
| 4. | Bae KS, Park JB, Kim HS, Kim DS, Park DJ, Kang SJ. Neuron-like differentiation of bone marrow-derived mesenchymal stem cells. Yonsei Med J 2011;52:401-12. |
| 5. | Huat TJ, Khan AA, Pati S, Mustafa Z, Abdullah JM, Jaafar H. IGF-1 enhances cell proliferation and survival during early differentiation of mesenchymal stem cells to neural progenitor-like cells. BMC Neurosci 2014;15:91. |
| 6. | Khan AA, Huat TJ, Al Mutery A, El-Serafi AT, Kacem HH, Abdallah SH, et al. Significant transcriptomic changes are associated with differentiation of bone marrow-derived mesenchymal stem cells into neural progenitor-like cells in the presence of bFGF and EGF. Cell Biosci 2020;10:126. |
| 7. | Li Z, Hu X, Zhong JF. Mesenchymal stem cells: Characteristics, function, and application. Stem Cells Int 2019;2019:8106818. |
| 8. | Caplan A. Mesenchymal stem cells in regenerative medicine. In: Principles of Regenerative Medicine. United Kingdom: Academic Press; 2019. p. 219-27. |
| 9. | Chang CC, Chang KC, Tsai SJ, Chang HH, Lin CP. Neurogenic differentiation of dental pulp stem cells to neuron-like cells in dopaminergic and motor neuronal inductive media. J Formos Med Assoc 2014;113:956-65. |
| 10. | Wobus AM, Boheler KR. Embryonic stem cells: Prospects for developmental biology and cell therapy. Physiol Rev 2005;85:635-78. |
| 11. | Kim K, Doi A, Wen B, Ng K, Zhao R, Cahan P, et al. Epigenetic memory in induced pluripotent stem cells. Nature 2010;467:285-90. |
| 12. | Razin A, Shemer R. DNA methylation in early development. Hum Mol Genet 1995;4:1751-5. |
| 13. | Moosavi A, Motevalizadeh Ardekani A. Role of epigenetics in biology and human diseases. Iran Biomed J 2016;20:246-58. |
| 14. | Moore LD, Le T, Fan G. DNA methylation and its basic function. Neuropsychopharmacology 2013;38:23-38. |
| 15. | Muhammad JS, Jayakumar MN, Elemam NM, Venkatachalam T, Raju TK, Hamoudi RA, et al. Gasdermin D hypermethylation inhibits pyroptosis and LPS-induced IL-1β release from NK92 cells. Immunotargets Ther 2019;8:29-41. |
| 16. | Geiman TM, Muegge K. DNA methylation in early development. Mol Reprod Dev 2010;77:105-13. |
| 17. | Lee C, Grant P. Role of histone acetylation and acetyltransferases in gene regulation. In: Toxicoepigenetics. Amsterdam, Netherlands: Academic Press; 2019. p. 3-30. |
| 18. | Fargo K, Pak T, Foecking E, Jones K. Molecular biology of androgen action: Perspectives on neuroprotective and neurotherapeutic effects. In: Hormones, Brain and Behavior. Amsterdam, Netherlands: Elsevier; 2009. p. 1219-46. |
| 19. | Tayabally SE, Khan AA, Abdallah SH, Khattak MN, Jayakumar MN, Rani Samsudin AB. Increased strength in the Col-Tgel induces apoptosis in the human dental pulp stem cells: 3D culturing of human dental pulp stem cells at different strengths of collagen. Saudi J Biol Sci 2022;29:2674-82. |
| 20. | Gopinath VK, Soumya S, Jayakumar MN. Osteogenic and odontogenic differentiation potential of dental pulp stem cells isolated from inflamed dental pulp tissues (I-DPSCs) by two different methods. Acta Odontol Scand 2020;78:281-9. |
| 21. | Arthur A, Rychkov G, Shi S, Koblar SA, Gronthos S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 2008;26:1787-95. |
| 22. | Király M, Porcsalmy B, Pataki A, Kádár K, Jelitai M, Molnár B, et al. Simultaneous PKC and cAMP activation induces differentiation of human dental pulp stem cells into functionally active neurons. Neurochem Int 2009;55:323-32. |
| 23. | Jaenisch R, Bird A. Epigenetic regulation of gene expression: How the genome integrates intrinsic and environmental signals. Nat Genet 2003;33 Suppl: 245-54. |
| 24. | Bell JT, Pai AA, Pickrell JK, Gaffney DJ, Pique-Regi R, Degner JF, et al. DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines. Genome Biol 2011;12:R10. |
| 25. | Klose RJ, Bird AP. Genomic DNA methylation: The mark and its mediators. Trends Biochem Sci 2006;31:89-97. |
| 26. | Cho YD, Ryoo HM. Trans-differentiation via epigenetics: A new paradigm in the bone regeneration. J Bone Metab 2018;25:9-13. |
| 27. | Zhang D, Li Q, Rao L, Yi B, Xu Q. Effect of 5-Aza-2'-deoxycytidine on odontogenic differentiation of human dental pulp cells. J Endod 2015;41:640-5. |
| 28. | Hermann A, Gastl R, Liebau S, Popa MO, Fiedler J, Boehm BO, et al. Efficient generation of neural stem cell-like cells from adult human bone marrow stromal cells. J Cell Sci 2004;117:4411-22. |
| 29. | Bai WF, Zhang Y, Xu W, Li W, Li M, Yuan F, et al. Isolation and characterization of neural progenitor cells from bone marrow in cell replacement therapy of brain injury. Front Cell Neurosci 2020;14:49. |
| 30. | Bueno C, Martínez-Morga M, García-Bernal D, Moraleda JM, Martínez S. Differentiation of human adult-derived stem cells towards a neural lineage involves a dedifferentiation event prior to differentiation to neural phenotypes. Sci Rep 2021;11:12034. |
| 31. | Morikawa S, Mabuchi Y, Niibe K, Suzuki S, Nagoshi N, Sunabori T, et al. Development of mesenchymal stem cells partially originate from the neural crest. Biochem Biophys Res Commun 2009;379:1114-9. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9]
|
Search Pubmed for